Journal: Brain

Article Title: Stepwise crosstalk between aberrant Nf1, Tp53 and Rb signalling pathways induces gliomagenesis in zebrafish

doi: 10.1093/brain/awaa404

Figure Lengend Snippet: CRISPR/Cas9-based deletion system in zebrafish. ( A ) Schematic illustration of the constructs of the CRISPR/Cas9-based vector, including the gfap promoter-driving Cas9, mCherry reporter, and U6-driving specific gRNA. ( B ) Strategy of the generation of the transgenic zebrafish lines. ( C ) F 1 transgenic fish generated by mosaic mCherry-positive fish outcrossed with wild-type fish. A subset of the transgenic offspring was identified by mCherry-positive astrocytes. Scale bar = 1 mm. ( D ) The colocalization of mCherry-labelled Cas9 and GFP-labelled endogenous Gfap in 60 hpf offspring from the cross of gfap WT and Tg ( gfap : GFP ) transgenic fish. Scale bars = 500 μm. ( E – J ) Co-localization of mCherry fluorescent signals (red) and endogenous Gfap detected by anti-Gfap antibody (FITC; green) in the brain and retina ( E – G ) or spinal cord ( H – J ) tissue. Scale bars = 200 μm. ( K ) Representative images of whole-mount in situ hybridization using an anti-sense RNA probe against Cas9 mRNA in 48 hpf embryos injected with Tol2 mRNA and gfap : Cas9-T2A-mCherry,U6 : gRNA ( null ) vector expressing Cas9 under the control of the gfap promoter. Cas9 expression pattern is governed by the tissue-specificity of gfap promoter (yellow arrowheads). Scale bars = 500 μm.

Article Snippet: We cloned the zebrafish U6-3 promoter ( Halbig et al. , 2008 ) from the AB strain, followed by an NheI site, into the CRISPR/Cas9 skeleton vector ( Cas9-T2A-mCherry ) from the Tol2 kit ( Kwan et al ., 2007 ) using ClaI and KpnI endonucleases (New England Biolabs).

Techniques: CRISPR, Construct, Plasmid Preparation, Transgenic Assay, Generated, In Situ Hybridization, Injection, Expressing

Journal: bioRxiv

Article Title: Hand2 represses non-cardiac cell fates through chromatin remodeling at cis- regulatory elements

doi: 10.1101/2023.09.23.559156

Figure Lengend Snippet: (A) Schematic representation of the hand2enh reporter construct. Construct contains a putative enhancer 28Kb upstream of the hand2 TSS (blue rectangle; hand2enh ), an e1b minimal promoter (orange) and eGFP (green), flanked by minimal Tol2 cis sequences to permit integration by Tol2 transposase. (B) Confocal images of reporter expression in the LPM of a 14hpf Tg(hand2enh:eGFP ) embryo (dorsal view, anterior to the top), and in the heart of a 48 hpf Tg(hand2enh:eGFP) ; Tg(myl7:cherry-Ras) embryo (ventral view). (C) Depiction of the Danio rerio hand2 locus with the CRISPR-Cas9 target site used to generate hand2 crispants at 260bp into exon 1, marked with a yellow lightning bolt. PCR primers used for fragment analysis to confirm CRISPR-induced mutagenesis are shown as red arrowheads. (D) Epifluorescence images of Tg(hand2enh:eGFP) embryos at 14 (dorsal view, anterior to the top) and 48 hpf (lateral view, anterior to the left): wildtype (WT), hand2 mutant ( hanS6 ), and hand2 crispant ( hand2 -CRP). White arrows indicate residue myocardial tissue in hand2 mutant and crispant. (E) Representative capillary electrophoresis traces of WT and hand2 -CRP embryos, plotted as the number of bases from the start of the amplified fragment. The percentage of cells with indel mutations for 9 representative embryos is indicated at right. (F) Confocal images of control (uninjected) and crispant Tg(myl7:nucGFP) embryos at 20-ss (19 hpf), ventral view. hand2 crispants have significantly fewer myocardial cells than wildtype embryos (unpaired two-tailed t-test; *p < 0.0001). (G) Confocal images, ventral view, of whole mount Tg(myl7:nucGFP) embryos at 19 hpf. WT and hand2 crispant transgenic embryos, immunostained with an antibody against aPKCs (purple) and nuclear-counterstained with DAPI (cyan); myocardial cells are labeled by myl7-driven nuclear GFP expression (green). Scale bars: 50um in B, D; 30um in F; 20um in G.

Article Snippet: Upstream cis -regulatory elements were amplified from wildtype zebrafish genomic DNA and cloned into the e1b-eGFP-Tol2 vector (available from Addgene, Plasmid #37845) by restriction cloning at the XhoI and BglII sites.

Techniques: Construct, Expressing, CRISPR, Mutagenesis, Residue, Electrophoresis, Amplification, Control, Two Tailed Test, Transgenic Assay, Labeling

Journal: bioRxiv

Article Title: Hand2 represses non-cardiac cell fates through chromatin remodeling at cis- regulatory elements

doi: 10.1101/2023.09.23.559156

Figure Lengend Snippet: (A) Confocal images of wildtype and hanS6 14 hpf embryos injected with the eDAR1031-e1b-eGFP reporter construct, showing reporter gene expression in the LPM (yellow dashed region) only in the hand2 mutant embryo (lower panel). Scale bars are 50um. (B) Quantification of wildtype and hanS6 embryos injected with eDAR1031-e1b-eGFP that exhibit eGFP expression within the LPM. “N” denotes the number of independent experimental replicate. “n” denotes the total number of embryos quantified. eGFP expression from embryos injected with the e1b-eGFP construct are shown as a control (*, p-value < 0.05, ns = not significant). (C) Putative Hand2-regulated gene network compiled based on the analysis of genes that are downregulated (blue text) or upregulated (red text) in the absence of Hand2. Lines with arrowheads signify an activator function for Hand2 in the indicated biological process while lines with a block arrow signify a repressive function for Hand2 in the indicated biological process. Dashed lines indicate Hand2 may either directly or indirectly regulate list genes. (D) Proposed mechanism of Hand2-dependent regulation of non-LPM and LPM-derived tissues based on the results of this study. Schematic of a 14 hpf zebrafish embryo is shown in the middle with the LPM colored in green. The embryo proper is colored blue while the yolk is colored beige. In the LPM, Hand2 positively regulate expression of LPM genes and limit the accessibility of non-LPM genes. In non-LPM tissues where Hand2 is not expressed, enhancers of non-LPM genes are accessible and can act on target non-LPM genes.

Article Snippet: Upstream cis -regulatory elements were amplified from wildtype zebrafish genomic DNA and cloned into the e1b-eGFP-Tol2 vector (available from Addgene, Plasmid #37845) by restriction cloning at the XhoI and BglII sites.

Techniques: Injection, Construct, Gene Expression, Mutagenesis, Expressing, Control, Blocking Assay, Derivative Assay

Journal: bioRxiv

Article Title: Altered lysosomal biology impairs motor neuron survival via TFEB dysregulation in spinal muscular atrophy

doi: 10.1101/2025.07.07.663525

Figure Lengend Snippet: ( A ) Scheme indicating the ALP functionality impairment potentially caused by an increased activity of TPT1 in SMA MNs (Biorender). ( B ) Scheme indicating the experimental design followed in C. ( C ) Quantification of mCherry fluorescence intensity by FACS analysis of a stably transduced HEK-LC3-TR line subjected to RNAi for 3 days to knock-down of the indicated targets (One-way ANOVA with Bonferroni’s multiple comparison correction, N= 4 individual experiments, each representing the mean of n= 3 technical replicates). ( D) Quantification of the number of APs (mch + ;GFP + ) per µm² and ( E ) the percentage of autolysosomes (mCh + ;GFP-) per cell stably transduced HEK- LC3-TR cells subjected to SMN or SMN + TPT1 knockdown (2-tailed Paired t-test, each circle represents an independent experiment, each representing the mean of n= 3 technical replicates. Samples from the same experiment are connected by a line). ( F ) Scheme showing lentiviral TPT1 knockdown in MNs. ( G ) Quantification of TPT1 mRNA expression levels measured by qPCR from WT and SMA types 2 and 1 MNs after TPT1 knock-down (N= 3, each representing 2 technical replicates. Two-way ANOVA with Fischer’s LSD test). ( H ) Representative images of DIV10 SMA vs healthy MNs treated for 9 days with sscr or TPT1 shRNA carrying LVs labelled with the live dye SiR-DNA (red). Scale bar, 20µm. ( I ) Fold change survival of hiPSC- derived ISL1 + MNs treated for 9 days with TPT1 shRNA LV relative to the survival of sscr- transduced MNs (One-way ANOVA, N= 5 individual experiments, each representing the mean of n= 3 technical replicates). Mean ± SEM is shown.

Article Snippet: Tg(mnx1:EGFP) embryos were injected with a mixture containing Tol2 transposase mRNA (40ng/ml, pT3TS-Tol2, Addgene plasmid # 31831), DNA plasmid containing one of the TFEB constructs (5ng/ml), and SMN-MO (McWhorter et al., 2003) (3 ug/ul, 5’ – CGACATCTTCTGCACCATTGGC – 3’, Gene Tools, LLC, USA) at the single-cell stage (final volume: 1 nl). mRNA coding for Tol2 transposase was generated by linearizing the pT3TS-Tol2 (plasmid Addgene #31831) with XbaI, followed by mRNA synthesis (AmbionTM mMESSAGE mMACHINE T3 transcription kit, AM1348, Thermo Fisher Scientific) and purification (RNeasy Mini Kit, Roche).

Techniques: Activity Assay, Fluorescence, Stable Transfection, Knockdown, Comparison, Expressing, shRNA, Derivative Assay

Journal: eLife

Article Title: Tumor initiating cells induce Cxcr4-mediated infiltration of pro-tumoral macrophages into the brain

doi: 10.7554/elife.31918

Figure Lengend Snippet: Figure 5. Cxcr4b signaling is required for the increase in microglia numbers following AKT1 overexpression. (A) To achieve expression in neural cells in the cxcr4b-/- mutant zebrafish line, a driver plasmid containing the NBT promoter (NBT:DlexPR-lexOP-pA) was co-injected together with either a lexOP: AKT1-lexOP:tagRFP plasmid to induce AKT1 expression or together with a lexOP:tagRFP-pA plasmid to achieve control RFP expression. Immunohistochemistry expression of (B) the human AKT1 protein and (C) Synaptophysin in the AKT1-expressing cells in the cxcr4b-/- mutant fish at 8 Figure 5 continued on next page

Article Snippet: The authors are grateful to Graham Lieschke for sharing mpeg1:EGFP fish and to Darren Gilmour for sharing cxcr4b-/- zebrafish. pcDNA3 Myr HA Akt1 was a gift from William Sellers (Addgene plasmid # 9008).

Techniques: Over Expression, Expressing, Mutagenesis, Plasmid Preparation, Injection, Control, Immunohistochemistry

Journal: eLife

Article Title: Tumor initiating cells induce Cxcr4-mediated infiltration of pro-tumoral macrophages into the brain

doi: 10.7554/elife.31918

Figure Lengend Snippet: Figure 6. Cxcr4b signaling in macrophages is required for the increase in microglia numbers upon AKT1 transformation in the brain. (A) To rescue Cxcr4b expression in macrophages or neural cells in the cxcr4b-/- mutant fish, a cell-specific rescue construct was injected in addition to the NBT driver and lexOP:tagRFP-pA/lexOP:AKT1-lexOP:RFP constructs. Cxcr4b expression was recovered in macrophages through the mpeg1 promoter (‘macrophage’ rescue) via a mpeg1:cxcr4b-pA construct. The expression of cxcr4b in neural cells (‘Neural’ rescue) was rescued through the lexOP: cxcr4b-pA construct. (B) Immunohistochemistry using a Cxcr4b antibody showed that Cxcr4b expression is completely absent in microglia and neural cells in the cxcr4b-/- fish (upper panels). Cxcr4b expression is partially recovered following the respective rescue conditions (lower panels). (C) Quantification of the number of microglia in cxcr4b-/- mutants overexpressing AKT1 before, and after Cxcr4b rescue in macrophages (‘Macrophage’ rescue: 119.5 ± 4.59, n = 28 vs cxcr4b-/- Akt1: 91.4 ± 5.22, n = 17; p<0.001, N = 39) and in neural cells (‘Neural’ rescue: 92.2 ± 4.40, n = 27, p=1 (n.s.), N = 3). (D) Quantification of the level of proliferation of AKT1-expressing cells in cxcr4b-/- mutants overexpressing AKT1 before, and after Cxcr4b rescue in macrophages (‘Macrophage’ rescue: 37.8 ± 1.45%, n = 45 larvae, vs cxcr4b-/- AKT1: 22.1 ± 1.73%, n = 27 larvae p<0.001, N = 3) and in neural cells (‘Neural’ rescue: 23.8 ± 2.08%, n = 22 larvae, vs cxcr4b-/- AKT1: 22.1 ± 1.73%, n = 27 larvae, p=1.00 (n.s.), N = 3). Error bars represent mean ±SEM. Images were captured using a Zeiss LSM710 confocal microscope with a 20X/NA 0.8 objective. Scale bars represent 100 mm. DOI: https://doi.org/10.7554/eLife.31918.016

Article Snippet: The authors are grateful to Graham Lieschke for sharing mpeg1:EGFP fish and to Darren Gilmour for sharing cxcr4b-/- zebrafish. pcDNA3 Myr HA Akt1 was a gift from William Sellers (Addgene plasmid # 9008).

Techniques: Transformation Assay, Expressing, Mutagenesis, Construct, Injection, Immunohistochemistry, Microscopy

Journal: eLife

Article Title: Tumor initiating cells induce Cxcr4-mediated infiltration of pro-tumoral macrophages into the brain

doi: 10.7554/elife.31918

Figure Lengend Snippet: Figure 7. High levels of Sdf1b produced by AKT1-expressing cells lead to increased microglia numbers. (A) mRNA expression levels of mif, sdf1a, and sdf1b in AKT1-RFP+ cells determined by qPCR (N = 3 for each gene). Fold change was measured in relation to control-RFP+ cells using the comparative (DDCT) method. (B) Quantification of the number of microglia in control WT larvae, and following Sdf1b overexpression in both WT fish (WT Control: 85.8 ± 2.45, n = 35 larvae; WT Sdf1b: 111.0 ± 6.08, n = 25 larvae, p<0.001, N = 3) and cxcr4b-/- mutants (cxcr4b-/- Sdf1b: 82.8 ± 3.51, n = 12, p=0.225 (n. s.), N = 3). Error bars represent mean ±SEM. DOI: https://doi.org/10.7554/eLife.31918.017

Article Snippet: The authors are grateful to Graham Lieschke for sharing mpeg1:EGFP fish and to Darren Gilmour for sharing cxcr4b-/- zebrafish. pcDNA3 Myr HA Akt1 was a gift from William Sellers (Addgene plasmid # 9008).

Techniques: Produced, Expressing, Control, Over Expression

Journal: bioRxiv

Article Title: A toolbox for efficient proximity-dependent biotinylation in zebrafish embryos

doi: 10.1101/2021.05.16.444353

Figure Lengend Snippet: (A) Cassettes compatible with the Tol2 trangenesis system were generated Proximity-dependent biotinylation in zebrafish embryos that express the selected fusion proteins (TurboID-LMNA and GFP, miniTurbo-LMNA and GFP) downstream of the heat shock inducible Hsp70 promoter. The cassettes also contain GFP under the control of a cardiomyocyte specific Cmlc2 promoter to allow selection of integration-positive embryos. (B) TurboID-GFP and miniTurbo-GFP transgenic embryos were heat shocked at 60 hpf for one hour and imaged at 72 hpf. Integration-positive embryos were selected prior to heat shock based on expression of GFP in the heart (yellow arrow). GFP expression 12 hours following heat shock is indicated by white arrowheads, and GFP expression in the eye lens by red arrows (magnification 16x, Scale Bar = 1 mm). (C) Immunofluorescence microscopy on embryos collected at 72 hpf following 1 hr heat shock at 60 hpf time point was performed as detailed in Experimental Procedures FLAG staining to detect the bait expression and streptavidin-fluorophore (Strep) to detect biotinylation. DAPI was used to stain the nucleus. (Upper panels Scale bar 50 µm, magnification 20x; Lower panels scale bar 5 µm, magnification 40x). (D) Number of high-confidence proximity partners for TurboID and miniTurbo, respectively. (E) List of the 27 common partners. (F) The 25 most abundant proteins (by spectral counts) with a BFDR ≤ 1% from the TurboID-LMNA experiment are listed, alongside their abundance across both conditions.

Article Snippet: To generate transgenic zebrafish lines, 30 ng of the final Tol2 destination vectors (purified using the QIAprep Spin Miniprep Kit; Qiagen cat. 27106) were injected into single cell stage zebrafish embryos together with 75 ng of Tol2 transposase mRNA (purified using the MEGAclearTM Transcription Clean-Up Kit; ThermoFisher Scientific cat. AM1908).

Techniques: Generated, Control, Selection, Transgenic Assay, Expressing, Immunofluorescence, Microscopy, Staining

Journal: bioRxiv

Article Title: A toolbox for efficient proximity-dependent biotinylation in zebrafish embryos

doi: 10.1101/2021.05.16.444353

Figure Lengend Snippet: To make the TurboID and miniTurbo constructs used in this paper available to the community, we cloned these constructs into the pCS2+ and pME vectors. The pCS2+ vector can be used for in vitro transcription of capped mRNA. This vector contains the TurboID or miniTurbo enzyme downstream of a SP6 promoter site and with a zebrafish consensus Kozak sequence at the start site. Downstream of the enzyme sequence is a multiple cloning site for insertion of a gene of interest, this is preceded by a linker in the TurboID construct. Both constructs contain a T7 promoter site and SV40 Poly A sequence at the 3’ end of the cassette. For generation of transgenic zebrafish, we provide TurboID and miniTurbo cassette within the Gateway cloning based Tol2 Kit pME middle entry vector. These vectors contain the Kozak and enzyme sequence as in the pCS2+ vectors with the addition of a linker and 3X FLAG at the 3’ end of the enzyme. The cassette is flanked by Gateway attL sites.

Article Snippet: To generate transgenic zebrafish lines, 30 ng of the final Tol2 destination vectors (purified using the QIAprep Spin Miniprep Kit; Qiagen cat. 27106) were injected into single cell stage zebrafish embryos together with 75 ng of Tol2 transposase mRNA (purified using the MEGAclearTM Transcription Clean-Up Kit; ThermoFisher Scientific cat. AM1908).

Techniques: Construct, Clone Assay, Plasmid Preparation, In Vitro, Sequencing, Cloning, Transgenic Assay

Journal: bioRxiv

Article Title: Lrrns define a visual circuit underlying brightness and contrast perception

doi: 10.1101/2025.05.05.652281

Figure Lengend Snippet: Gfi1ab and Lrrns are expressed in the developing RGCs of the zebrafish retina and are required for RGC wiring assembly. (A-A I ) Confocal images of 3 dpf Tg(gfi1ab:gal4;isl2b:GFP) embryos injected at the 1-cell stage with a 10UAS:lynRFP plasmid. (A) Gfi1ab:gal4 expression (magenta) is sparse in RGCs compared to the pan-RGC marker Isl2b (green). (A I ) Gfi1ab -RGC axons project within all sub-laminae of the tectal neuropil. (B-D II ) Confocal Z-stack images of a 3 dpf retina stained by multiplex HCR in situ hybridization for lrrn2 (cyan), lrrn3a (magenta), and lrrn3b (green) showing their relative expression in the GCL and ACs. DAPI (gray) highlights retinal layers. (B-B II ) Single-channel expression of lrrn2 (cyan), lrrn3a (magenta), and lrrn3b (green). (C-C II ) Partial colocalization of lrrn2/lrrn3a , lrrn2/lrrn3b , and lrrn3a/lrrn3b . (D-D II ) Magnified images using Cellpose to identify colocalization within RGCs. (E-E) Quantitative RT-PCR analysets of lrrn isoforms expression in gfi1ab-/- mutants at 2 and 3 dpf. Significant downregulation of lrrn2 ( p = 0.0286) (E) and lrrn3a (E’) is observed at 3 dpf ( p = 0.0286), with only lrrn3a down-regulated at 2 dpf ( p = 0.0286). Data are mean ± SD; n = 3 technical replicates, 50 heads per condition, n = 4 biological replicates. (F-F I ) Quantitative RT-PCR analyses of lrrn isoforms expression in single mutant lrrn2 (SM-2) and single mutant lrrn3a (SM-3a) mutants at 2 and 3 dpf. Lrrn3a is upregulated in SM-2 at 3 dpf ( p = 0.0286) (F), and lrrn2 is upregulated in SM-3a at both 2 and 3 dpf ( p = 0.0286) F’. Data are mean ± SD; n = 3 technical replicates, 50 heads per condition, n = 4 biological replicates. (G-H I ) Confocal imaging of axonal projections of 3 dpf WT (G) and lrrn2 -/- ; lrrn3a -/- double mutant (DM) embryos (H) Gfi1ab-RGCs in the Tg(gfi1ab:gal4;isl2b:GFP) background injected with a 10UAS:lynRFP construct for mosaic labeling of Gfi1ab-RGC axonal projections. WT Gfi1ab-RFP positive RGCs target unique tectal laminae, whereas DM Gfi1ab-RFP positive RGCs show mistargeting in the deep SAC/SPV region. (G II , H II ) Magnified views of SAC/SPV-RGC axons. (I) Percentage of correctly targeted and mistargeted Gfi1ab-RGCs in WT, DM, and SM embryos. (J) Quantification of the average absolute distances (μm) of RGC axonal tips from the skin for panels (G) and (H), showing a significant difference in the SAC/SPV layer of DM larvae compared to WT. Data are mean ± SD. p < 0.0001. Scale bars = 30 μm, unless stated otherwise. Statistical significance was determined by a Mann-Whitney U-test: ns – p > 0.05; * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001. Abbreviations: AC = amacrine cells; GCL = ganglion cell layer; IPL = inner plexiform layer; OT = optic tectum; RGC = retinal ganglion cells; SAC = stratum album centrale; SFGS = stratum fibrosum et griseum superficiale; SGC = stratum griseum centrale; SO = stratum opticum; SPV = stratum periventriculare; AF9 = arborization field 9; WT = wild-type; DM = double mutant ( lrrn2 -/- ; lrrn3a -/- ); SM-2 = single mutant lrrn2 -/- ; SM-3a = single mutant lrrn3a -/- .

Article Snippet: The pDest-Tol2-Isl2b:GFP:polyA was obtained from Addgene (plasmid n. 105648).

Techniques: Injection, Plasmid Preparation, Expressing, Marker, Staining, Multiplex Assay, In Situ Hybridization, Quantitative RT-PCR, Mutagenesis, Imaging, Construct, Labeling, MANN-WHITNEY